|
Sangon Biotech
pcdna3 1 myc rsv a n Pcdna3 1 Myc Rsv A N, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/cas9+plasmid+puromycin+recombinant+sgrna/pm42286185-186-35-51 Average 86 stars, based on 1 article reviews
pcdna3 1 myc rsv a n - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tccctccactcggaaggac sangon biotech n a primer c myc reverse Tccctccactcggaaggac Sangon Biotech N A Primer C Myc Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/primer/pm42054210-662-185-186 Average 86 stars, based on 1 article reviews
tccctccactcggaaggac sangon biotech n a primer c myc reverse - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
cctgagacagatcagcaacaa sangon biotech n a shrna c myc Cctgagacagatcagcaacaa Sangon Biotech N A Shrna C Myc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/a+biotech+c+gcgtgtctatacctgtgaaat+myc+n+sangon+shrna/pm42054210-663-89-90 Average 86 stars, based on 1 article reviews
cctgagacagatcagcaacaa sangon biotech n a shrna c myc - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
gcgtgtctatacctgtgaaat sangon biotech n a shrna c myc Gcgtgtctatacctgtgaaat Sangon Biotech N A Shrna C Myc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/a+biotech+c+gcgtgtctatacctgtgaaat+myc+n+sangon+shrna/pm42054210-663-83-84 Average 86 stars, based on 1 article reviews
gcgtgtctatacctgtgaaat sangon biotech n a shrna c myc - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward Ggttcatcagcatccgagtaga Sangon Biotech N A Primer C Myc Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm42054210-662-178-179 Average 86 stars, based on 1 article reviews
ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Novus Biologicals
mycn Mycn, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/n-Myc+Antibody+(NMYC-1)+-+BSA+Free/pm42014700-311-19-21 Average 93 stars, based on 1 article reviews
mycn - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti n myc Anti N Myc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/pmc13049659-10-0-4 Average 86 stars, based on 1 article reviews
anti n myc - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
c myc C Myc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/c-Myc%2FN-Myc+Rabbit+mAb/pm41926649-184-63-65 Average 96 stars, based on 1 article reviews
c myc - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
antibodies against abcb1 Antibodies Against Abcb1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/c-Myc%2FN-Myc+Rabbit+mAb/pm41923105-77-8-11 Average 96 stars, based on 1 article reviews
antibodies against abcb1 - by Bioz Stars,
2026-09
96/100 stars
|
Buy from Supplier |
|
OriGene
nmi overexpression Nmi Overexpression, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+myc/N+myc+interactor+(NMI)+(NM_004688)+Human+Tagged+ORF+Clone/us12590333-672-1-7 Average 94 stars, based on 1 article reviews
nmi overexpression - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |