Review





Similar Products

86
Sangon Biotech pcdna3 1 myc rsv a n
Pcdna3 1 Myc Rsv A N, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/cas9+plasmid+puromycin+recombinant+sgrna/pm42286185-186-35-51
Average 86 stars, based on 1 article reviews
pcdna3 1 myc rsv a n - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech tccctccactcggaaggac sangon biotech n a primer c myc reverse
Tccctccactcggaaggac Sangon Biotech N A Primer C Myc Reverse, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/primer/pm42054210-662-185-186
Average 86 stars, based on 1 article reviews
tccctccactcggaaggac sangon biotech n a primer c myc reverse - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech cctgagacagatcagcaacaa sangon biotech n a shrna c myc
Cctgagacagatcagcaacaa Sangon Biotech N A Shrna C Myc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/a+biotech+c+gcgtgtctatacctgtgaaat+myc+n+sangon+shrna/pm42054210-663-89-90
Average 86 stars, based on 1 article reviews
cctgagacagatcagcaacaa sangon biotech n a shrna c myc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech gcgtgtctatacctgtgaaat sangon biotech n a shrna c myc
Gcgtgtctatacctgtgaaat Sangon Biotech N A Shrna C Myc, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/a+biotech+c+gcgtgtctatacctgtgaaat+myc+n+sangon+shrna/pm42054210-663-83-84
Average 86 stars, based on 1 article reviews
gcgtgtctatacctgtgaaat sangon biotech n a shrna c myc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Sangon Biotech ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward
Ggttcatcagcatccgagtaga Sangon Biotech N A Primer C Myc Forward, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/a+biotech+forward+ggacagagagaaaggaataaacaacc+n+primer+sangon+usp15/pm42054210-662-178-179
Average 86 stars, based on 1 article reviews
ggttcatcagcatccgagtaga sangon biotech n a primer c myc forward - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

93
Novus Biologicals mycn
Mycn, supplied by Novus Biologicals, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/n-Myc+Antibody+(NMYC-1)+-+BSA+Free/pm42014700-311-19-21
Average 93 stars, based on 1 article reviews
mycn - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

86
Cell Signaling Technology Inc anti n myc
Anti N Myc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/pmc13049659-10-0-4
Average 86 stars, based on 1 article reviews
anti n myc - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc c myc
C Myc, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/c-Myc%2FN-Myc+Rabbit+mAb/pm41926649-184-63-65
Average 96 stars, based on 1 article reviews
c myc - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
Cell Signaling Technology Inc antibodies against abcb1
Antibodies Against Abcb1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/c-Myc%2FN-Myc+Rabbit+mAb/pm41923105-77-8-11
Average 96 stars, based on 1 article reviews
antibodies against abcb1 - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

94
OriGene nmi overexpression
Nmi Overexpression, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/n+myc/N+myc+interactor+(NMI)+(NM_004688)+Human+Tagged+ORF+Clone/us12590333-672-1-7
Average 94 stars, based on 1 article reviews
nmi overexpression - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

Image Search Results